EST 281203 is a singleton


Sequence

>281203 (1 EST) Length=340 GAGTTGCCCATACTAAGTATTTGCAGCCCTCTGTGATGTGTAGTATGAGGGCCGGTGTTGTTGAACAAGTTACAACATCC CAAGATATTCTAGATGGAATCCTCAGTTAGTTACGACAATTGGTTCTAACGCCTTTAGCCCAGAAGGCGAGAGTAGAGGT TTTGTTGCAGCAATACCAAGGAAGGGGATGGCATTATCAAAGAACAGTAGATGCAGCGCGACTTATGCGTTAGTGNACTC TTGAGACAGATCACACGACAAAATGGGGTGCCGACACATTCAAGTTGGCCCCAGTGTAGCTAACTTTCACAGGAATGGAA TCAGGAATTTATTCGATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 281203: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281203889960H21265AS3ISB328SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 12:16:41 on Mon 20 Nov 117.