EST 281206 is a singleton


Sequence

>281206 (1 EST) Length=223 GGAAAATAGAGGGGGAGATAGATCAGGAAACGGGCTAAACATCGGGTCAGGATTTAAGCTGATTTTAATCGAATATTTTC ATTTTGGGGGAAGCTGGATGGGGTAGTAATGTTAGGATGTGATTCACTGGCTTACAGGTCGTTAGTGGCAAAATGTCCCT CAGCACATTGGCGGGCAAAGTAGCCGGAAAAGGGACATCGATCCTGAAAAGTGATTCCTTTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 281206: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281206889963H21268AS3ISB200SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 6:45:42 on Tue 21 Nov 117.