EST 281234 is a singleton


Sequence

>281234 (1 EST) Length=372 GCACATATATATAGCATTGCATGGCTGAATACACAGTCTGACGATGTTGGAGGTGGGNGTCGTGGCGCATNCTCAGTATA GACGGATGGGACAGTCACAGGGGGTTGAAGGATACGGCAGGTGGTTAANCCGAGATGAAGCAAACGCAGGTTGCTTGGAC TGAAATAACTACAAATTAATGGTTATGATGGACTAGGAAAGCATGGGTAGAATGTGTTGGTCTGCATATCAATTCTGTGT TGAATCTTCGGATACATGGAATAGGTCATACTGATGTCAGGATTTCATTCAATTCGGACGGTATATTATTCTCAAATACA GTTGTTGCGCTTGTTTAAAAAACTGGCAACTCGGAAGGAGTTCGTTATCAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 281234: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281234889991H21296AS3ISB253SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 22:20:27 on Sat 18 Nov 117.