EST 281256 is a singleton


Sequence

>281256 (1 EST) Length=169 TTCGTGTAGTTTCTTGATCTCGCAGGGAAAGAAATTTGATAATGGATGGATATATTATGGATATTCATCAATTTGATATC AAGTGAGTGTAAAAGTCCAAAAAGACCATGCGTGCGAGGATCAAGCTTGATCCAGTACCTTGCGACCTACGTAGGGGGGG TCCGGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 281256: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281256890013H21318AS3ISB250SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 11:33:24 on Fri 24 Nov 117.