EST 281265 is a singleton


Sequence

>281265 (1 EST) Length=436 CTTTTCTTTGTGCCTTAAGAGGAATGGTCGACTTGGTTTGATGGGAGAATAGGTGAAGCAATTGCTACAAGTCCGTGTAA CAAAAGGTGCTCTTCATCGTCTAATATCTCAGCAATCCGTCAGAGAATATCGATGAACACTGTCTGTGAGTGGCACAGCT GTGGGATAGTGATTGATAACAATATTTGCCAACCAGCTTTGGCGGGTATACGTTTTTTTCAAGGAACCGACACGGGAGGG GAGCTTGCTCACATATCTCCCGTTTTTGTTGTGCCAGCATCATCTGTTATCGACCTGAAAGGGAAGCCTTTAGATGTTAT TACAGGCACTGACGAACTGACTGAAGAAACCTTAGAACAAAGACTCAAGATTGCTATGAAGACTTGGAACGATGCTCATC AACCTTCCATCCTCTTCCATTAACTTGGCCCTAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 281265: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281265890022H21327AS3ISB259SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 13:50:11 on Thu 23 Nov 117.