EST 281846 is a singleton


Sequence

>281846 (1 EST) Length=520 TGCGGCAAGATTGTTTGAAGGTACGAATTGGAACCATATGGAGTAATTGTAGTAGTCTTATTTCCGGGAACCTTCCAAAC TGGATTGCATGTCATTCAGGAACTGCATCGTATGATTGATTTCCTATGGAATCGATCGTCGCAAGAAATTCGCAACGAAT ATGGAAATGATTTTAATGTGAAAGCGAAAGCATTCGCAAATGAAATGCTATCAAAGTTTTTGTCGAAAGATACAGAAAAG GTTATCGATGCTTACTATGAAGCCATCGTTGCGAGACGACCAAAGCTTTCCTATCGAATTGGTTGGGAAACGTCGCTAAT CTTCTATCCATACTCATTCATGCCGCTAAGGGTACAGTGTCATCTGATGAAGTTCTTAATGAAATTGGTTTGGGAGCACC AGGTACGGGAAGCAACCCGGTTCCGGAAACAGGGAAACTTAGAGACTGATTCAAGTTCACAATAATATTGGCTGGAAATT TCGGATGGAAACCAAAGTTTGGTTCTTCTCGGGTAAAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 281846: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281846890030H21335AS3ISB338SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 14:47:44 on Sun 19 Nov 117.