EST 281852 is a singleton


Sequence

>281852 (1 EST) Length=113 GTTAAAGAAAAAGGGAAGAAAAGATCATCTTTAAGCGTTATTGGTCATGTATGAGAATCAGTTGAGGCGTCGATTCATCG GTATCGCATGACACAGGGTGAGTGACGCGCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 281852: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281852890036H21341AS3ISB348SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 12:21:20 on Fri 17 Nov 117.