EST 281857 is a singleton


Sequence

>281857 (1 EST) Length=147 CCTGGAAACAGTCGAGAGACTAAAAGGATGGCACATCTCGAGAACACGTAAGGAGGACGGCAGGTATTCCTCACTCGACG AAGCTGCCGCTGCCTGTCCCAGTTCTCCATCCTCCTCCAGCGGAAAAGATATCGGAGTTACTGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 281857: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281857890041H21346AS3ISB354SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 9:3:14 on Sat 18 Nov 117.