EST 2821 is a singleton


Sequence

>2821 (1 EST) Length=262 ATATAATTGATAACTTAAATAATAATATTAACGATATTCTAAACTGCATTCAGAATTCCTCCAATAATAGAGTACTAAAT AATCATTTCAGTGGTATCAGTAGTGTTAGTAATGAAACTATTTACAATTTAAATATAACAAATAGANGAAATAGTCATAA TATTNCANCTAACAATATTAATAATACANNTNCGTTACAAGAAAATACAGAAACAAATAATACTTCTAATGTTAACAATT TNGGTGGTATAANTNCTTTNTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2821: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2821319159T026390012M3gmbPfHB3.1, G. Roman Reddy


Date: 19:11:19 on Fri 24 Nov 117.