EST 2824 is a singleton


Sequence

>2824 (1 EST) Length=327 TTATTAGTTATTAAAATTCAAACATTTAAGTGCAGGCAGCTGAGCAACATCCAGCTGGNTTAATTTCTTCAGATGATAAT CTTTTNAATTGCATGCTTCCACTTGGTTCAAAATTGGATGCTTGAATACTTCTTTCTTGTTCAAAATTTGCTCCACTGTA TTGATTGTAAAAGTNCATTTGAGAGAAATTTTCACCACTAGCATTATTTNGTNATTTANCACTAGACTGTTTATTCAATA ATTCATAGCTTCTGTNGAATGCATTTNGATTATAAGCATTTNCATTAAATNGGTTGAAANGAGTTTGCCTTGTTGGTATA TATNNTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 2824: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2824319162T026420014M3gmbPfHB3.1, G. Roman Reddy


Date: 12:3:43 on Mon 20 Nov 117.