EST 2826 is a singleton


Sequence

>2826 (1 EST) Length=356 TTACCTTATAAAAAACGGCCATTATCATAAATGCACCCATAAATAGGGTAGCAATCTGGNTCATAATATTAAGTATGTTT GAACCTTTGTATCCATTATTNCTGTGTAATGAATGTGCAATACTTCCATCTGATCCTTTGATAGTNATTTGTGGGGATTG GTTTTCATTTTTAACCATTCCACTTTGTTCATGAGAAGATAATATTTGTNACAAGTAATATTTTGTATCTAAATGGCTTT GTGCACTATGGTGAAATGAAGGTGAAAAAGTAAAAGTATTATGTGAATTTCCTGNTGTAGGANTAAATACCTNGGCGANG TGAAGTGTNACCCTTCCCTGAATTGTTTTGTCCGTN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 2826: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2826319163T026440015M7gmbPfHB3.1, G. Roman Reddy


Date: 2:40:17 on Mon 20 Nov 117.