EST 2828 is a singleton


Sequence

>2828 (1 EST) Length=360 TATTTNATTTTATTTTATTTAATTTTTAATTTTATTATTTACCTGAATGCCATGGGTCTCATATTTCTACTTATCATAAA CTCATTCAACATACGTATATTTATATACATATAATANGCATAGTAAGANTATGGAGGATTATGTNCACTTACATATTTAT CAGGTGTTGGTAGCTCCCCTCCCTTTAATGTATAATNCGAAATAATAGATTCATCATCTACACTGTCCCATCCAACAATT TGATGTAAGANTATAAATNTTCCNNTATTTCCTNCTGGNTTTTTGATAGCTTCAAAACAAGGTGGAANTATATTNCCTTA GGAAATCTGCAAAAGTNATTTATNAGGTNNCATTTTTTNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2828319165T026460016M7gmbPfHB3.1, G. Roman Reddy


Date: 16:1:15 on Fri 17 Nov 117.