EST 2833 is a singleton


Sequence

>2833 (1 EST) Length=363 AGCTTGATTATTTGGCACCATCAGATTGTTTTCAAGCGAAAACAGGTGAATTGCAGCAGTATATTCCGAATAATTATTAT CGTGTTAAATGGATTGANTCTTTACGAAGTGGTGAATATTTAGGGGAAGATTACCCATGGAATTTGCTTCCAAATTGGAA ATATTGGAGAAAGCGAAAGTACAATGTTAAATATGAAGAAATTCCTTGGTTTATTTCGAAGGTAAAGGGAGTTTCTNATT ATAAAAGATTGAATGTGTGGATGGTACAATGGGTGGAAATGGGGACATCGATTCAGAAGGTTAGGTGTGCATTTGGTTNT TACANGCCAAACTGGCTGCTGANCAATNCAGGAAAATTTGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2833: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2833319170T026510023M7gmbPfHB3.1, G. Roman Reddy


Date: 23:25:43 on Mon 20 Nov 117.