EST 2840 is a singleton


Sequence

>2840 (1 EST) Length=203 TTAATTACAAGAAAATTCGTTGTCAGTTCAACAATGATAATTATATTAGGATATTTCTTTTATAAAAATCATGAGAGCTA TTATTATATATATGTGGTTTACACCCATAACAACTATTGATCTACACATTTGTATGTTATTTAAAATAAAAANGGTTGTT TGTAAACACCGTTTTACTTGTTATGTCGATTTATAAAANTANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2840: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2840319177T026580027M3gmbPfHB3.1, G. Roman Reddy


Date: 10:27:56 on Sat 18 Nov 117.