EST 2843 is a singleton


Sequence

>2843 (1 EST) Length=213 TCCATCTTTTAATTTGTACTTATTCTTTTTTCTTTTTGGTGTGTGATGGAGTATATATTTTATTAAAACACATAAAATAT GGAGATGCAAAAAGATAATTAAAATTATTGTATTCAAAATTTGTTCTAATAAAATTTTAATTAAAGTGTGTTTGAATATA TATAATAACAATATTTAAAATTATCAATTTTAATAATGTAAATAAACANAAGN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 2843: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2843319180T026610028M7gmbPfHB3.1, G. Roman Reddy


Date: 12:3:20 on Thu 23 Nov 117.