EST 2851 is a singleton


Sequence

>2851 (1 EST) Length=87 TTTGTAAAGGGATNTGTTATGGGTATATATACCAATTTGTAAAATGAATTGAGTGAAGTGCTGTGACTGTATATTATAAT TTGTNTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 2851: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
2851319188T026690033M7gmbPfHB3.1, G. Roman Reddy


Date: 5:12:3 on Tue 21 Nov 117.