EST 28589 is a singleton


Sequence

>28589 (1 EST) Length=128 TGATTATAATATTGAAGAATATAATAATGAAATAAAGAAAGAAAAAGAAAAAGAAAAAGAGAGCGATAGAAAGCAAATNT TCAAACTTGCCATAGAATTAAAAAATGGCTCAAAAAAAAAAAAANNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28589: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28589319325T026360010M3gmbPfHB3.1, G. Roman Reddy


Date: 18:49:0 on Thu 23 Nov 117.