EST 28604 is a singleton


Sequence

>28604 (1 EST) Length=258 AACTAATATATGAAAAAAGATTTTTAAAAAATAAAAACAAGCAAAATAAAATATAAAATAATATAATACATCATAAGATT CATAATATATGATATATATACATATAATTAANTTTTAATGATTTCCAAAGANTGACGAATAATAAAAAAATATAACAATT TTTTATANAAANAGANAAAAANTTATAAAATAANTAAAATTATAAGGGACGATTTTAATATATCACAACATGTCAACATC ACATATAGNCGCAGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28604319340T095080098m3gmbPfHB3.1, G. Roman Reddy


Date: 6:12:55 on Sun 19 Nov 117.