EST 28626 is a singleton


Sequence

>28626 (1 EST) Length=359 AGATGCAATATTTAAATCATATGTATTTAATATTATTAAACCACATCTACTTATAGTAGCCATCGTTATATTTTTTAAAT TATATGTTTCCATAATAAAATGGGTATGATTATATATAGGAATAATATCACATTTTGATAAACATAAAATTTTGGATTCA TCTAAAACAGAATTTAAATTTTCTATCCATAAAGAATGTAAATAACAATCAAAATATATTATATTTAAATAATTATCTGT ATTATTNTAAGTGGTATTAATTTCTAAAATTTTTTTAGGTTAATATTCCATGGACCCCNTTTTATTTGGAACCTCCTTCA TAAAATCCCTAAAAGGGCCNTTTTCCCTTTTCCACCATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28626319362T095300145m3gmbPfHB3.1, G. Roman Reddy


Date: 17:8:32 on Fri 24 Nov 117.