EST 28631 is a singleton


Sequence

>28631 (1 EST) Length=327 TATGTGTGTGTGTGTGATGTGTATATGTTCGTGTGTATATATATATGCTGAGAAGATAAAACAAAATTGTTTATATTTAT ATATTACACTTTTGTAAAATATAATATTTTACCTGTACAGATTTGCGGAGTCTTAAAAATATNATCACCTTAGCTTGCGG CCNTNTGTNATGGTTTAAATTTACCTACAAATTCCAAGTCAGCTATAATAAGAAATGGAATAAACGGAATGATATTATTT GGAAAAGTATTTTTCCAAAAATTTAATGAACCATATTATTGGCGAGTTNTGGNTTTGCTGATATTATTTCCATCCTTCTT GGCCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28631: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28631319367T095350147m7gmbPfHB3.1, G. Roman Reddy


Date: 20:53:31 on Wed 22 Nov 117.