EST 28644 is a singleton


Sequence

>28644 (1 EST) Length=361 TGTAGGTACTAACATAGGTCTTAATTGTACTTATGTAGCTCTTACTTTCACAAAAGTAGGCCTTGAAATGATTAATATAA GACTTAGTATAAGTAAAAACTAGGTCTTACTATTACTAATATAGGTCATAAAATTACTAAGCTAAGTCATTAAGGTACTA ACGTAGGTCCTAAGGTAACTAATATAGGTCCTAACATTACTAACTTTGGTCTTAAGTTTAGTAACATAGGTCTAAGGTAA GTAATGTAGGTCTTATGGTAACTAAATATAGGTCCTAATATCACCAAACCATAGGTCTTTAAGGTAACTANACTTAGGTC CTANCATTACTACCCTAAGGTCTAAAAGGGTAACTACATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 28644: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28644319380T095480155m3gmbPfHB3.1, G. Roman Reddy


Date: 21:10:7 on Fri 24 Nov 117.