EST 28645 is a singleton


Sequence

>28645 (1 EST) Length=384 CTGTAGTTAGGTCCTAACTTAGTGATATTAGGACCTATATTAGTTACCTTAAGACCTACATTACTGTAATTAGGATCTAT ATTAGTTACCATAAGACCTAAATTAGTTACCATAAGACCTACGTTAGTGATACTAGGACCTATATTAGTTAACATAAGAC CTACGTTAGTGATATGAGGACCTATATTAGTTACCTTAAGACCTATGTTAGTAATATTAGGACCTATATTAGTTACCTTA TGTCCTATGTTATTGTAGTTAGGNCCTATACTACTTACCTATAAACCTATGTTGCTGTAGTTAGGACCTCTATTAGTTAC CTTAAAGACCCTATGTTAGGCCAAGTATGGACCTTAGTTAGGTAAAAGGTAAGGCCTTAATGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 28645: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28645319381T095490155m7gmbPfHB3.1, G. Roman Reddy


Date: 2:50:50 on Sat 25 Nov 117.