EST 2865 is in sequence 28651


Sequence

>28651 (1 EST) Length=360 TGTATATTGTTTACCAAGGTGTTCTATGAAAGCAACAATATTGAATATGATTTCATCATCATCAGCAAATGATCCGAATA TTAAAACATTTGATTATAAAAATTATTGGTTAGATATACATGGATATTTATTAAATGATATGAGTATAGATAAAATTGTA CAAGTTAGATTATATAAAGGTATATTCAATTACCCACAAGGGGTATTATTAAGAGATAATATATATAANTNAAATATACC TATTAGAAAGGNGCATACATTATATATATGTAGGTTATCTGAAGCAATTTCAATTACTANCCAANTTCGGGAAATGGTTA TATTGGANCCATTCAGGCCATTTTTNCATTTTTCCAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28651: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28651319387T095550160m3gmbPfHB3.1, G. Roman Reddy


Date: 18:58:3 on Sun 19 Nov 117.