EST 28655 is a singleton


Sequence

>28655 (1 EST) Length=368 AAGTATATATTACAGTATATAGACTTGAAAAAAATTAGGAAAATATAAATTTGTGTAAAAAGGAAAAAAAAAGAACAGGG TCAAATTTTGTTAATTTTGAGAATAATTATAGNTCTATATATTTGTATAATTTTGGAAAAGAAAAATGAATGAATGAATG AATGAATGAATAAATAAATAANTCAATAAACAAATAAATATAATTNTGTTTTGCTGTTGTATATTAAAATATGTTTTATT ATTNATATTTGTTTTGCCATGTTGNAAAAATCGGAAAAAATTCATATACATATATATGGNCCAATTCAGTTTTTATTTGT TTCCCATATTCTGCACCATGTCTGNGCTCTTTNCAAAATGGNACAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28655319391T095590162m3gmbPfHB3.1, G. Roman Reddy


Date: 4:28:13 on Mon 20 Nov 117.