EST 28661 is a singleton


Sequence

>28661 (1 EST) Length=317 GAGATATTACTATATATTTTGTATGGTATTTNCTAATTGTNCTTTGAAGAAAATTTCGTTTGATGTATTAATATCACNTT TTAATTTCGTCTGTTTGAATATGATCATTTTTNATTTCGTCTGTTTGAATATGATCATTTTTTATTTCGTCTGTTTGAAT ATGATCATNTTTNATTTCGTCTGTTTGAATATGATCATTTTTTAATTCTTCTGTTTGAATATGATCATTATTTATNTCGT CTGTTTGAATATGATCATNTTTAATTTCGGNCTGTCTGAATATGANCATTTTTNATNTCCGCCTGTTTGAATATGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 28661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28661319397T095650165m3gmbPfHB3.1, G. Roman Reddy


Date: 2:16:13 on Wed 22 Nov 117.