EST 28664 is a singleton


Sequence

>28664 (1 EST) Length=328 TTATTTATATATATATATATNTNCTGAACTATTTTNATATTTTCTTTCTTTCCCTTTTTTTTTTTTTTTANNAATATATA TCCATATTGAAATATATGCTATTTTATGAATATACTATTGTGTAAATCATATAGTTTTTGCTTAATCCTTTTTCTTAGCA ACTTTCGATGCTCCACTTTTCATACAACAACATTTCAATAAAATTAAAGAAAAGATGGAACCTGTTAAGAATGATACGGA TACAAGANCAGCTAAGGATGGGAAAGCGTATTTATAAATCCNATCTATATTTTGAAAAGNTTCATTCAAAAAATCTTTAA GGGTATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28664319400T095680167m3gmbPfHB3.1, G. Roman Reddy


Date: 17:51:4 on Mon 20 Nov 117.