EST 28672 is a singleton


Sequence

>28672 (1 EST) Length=320 ATTTTTTTGAGAAAGGAAAAAAAAAGAAAAAATGCAGAACCTTTTAAATACCAGCAAATTATGTGAAGTGCTCGAGGGTT CCATAAGCGCTTCAAAGGAGAAAAGAATTGAATGTGAAGAATACTTAAAACAAATAACTAAGGTTGATGGTTATATGAAT GTTATATTAANCATAGTGAAGAGTATTAATGTTGTTGATGACAATATTAGGATATCAGCTTCCATATTTTTAAAGAATAG TATTAGAAACANTTATGATGTATTGAAAAANGNNGAAGTATGTACTTTAACAAAAGGTATATATGAAAGCTTATTATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28672319408T095760173m3gmbPfHB3.1, G. Roman Reddy


Date: 15:11:24 on Thu 23 Nov 117.