EST 28682 is a singleton


Sequence

>28682 (1 EST) Length=338 ATGTATTATTTTATAGCCTATGGATTAATCGTGATGTTATGAAAACGTATCAAATAAAANACGTACTTTTTTTTTTCTCA TTATATAAAANTAATTTTATTTTGAATAATGTGGACTTAGGAAATACAATNTATAATTGGTATAATAAACGTTTAATATA TTTNATAAGAANACAAATAGAAATTTATTTTGAACATCATTCTTTAGAAAATAGTATAAGANGTATATTCCTTTTAACGG ATATTTTAAGTTACAATAAACTACTNCAANANATATTAATGTAAAANTTGGNGCTGTTAAATATGCAAAACATTTCCCCT TTCACTCTTTTTGTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28682: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28682319418T095860180m7gmbPfHB3.1, G. Roman Reddy


Date: 16:15:4 on Tue 21 Nov 117.