EST 28684 is a singleton


Sequence

>28684 (1 EST) Length=391 CAACTCCTATATCAGGATATGCATATAAAAATCCAACAACTTCCAAATTTAACATTTTCGCTAGCTGGTCTGCTCTTTTN CTATCTTCACTATGTAAAAGATATTTTTCATCATATCCTTGTTCAGTTTTATTCATTGAAAAGAAAACATGCTCAACTTT TACAAATTCATCTCTTTCATATTTNCCATATAATACTCCACAAAAATATTTATTATCTTTAGGATTCTTATTTTTAAGAT TCATATAATTCACTTCACTATAAAATTNCTGTATATNATATAANCACGTTTCACTAACGNTTACCTTTTTACAAAGNGNT TGAAATAAAGGNTTTATCGGNTNTCTGTGNATNATTGTCCAAANTGGNGGGCAATTTTATTTCCCTTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28684319420T095880181m7gmbPfHB3.1, G. Roman Reddy


Date: 12:50:26 on Fri 17 Nov 117.