EST 28687 is a singleton


Sequence

>28687 (1 EST) Length=322 TTATTGTTATTATCATCTTCATTATTATTACTATTATAGCTACTATTACTATTATATCCATTATTATTATCTGTACTATC ATTATACCCATTATTATAATTGTCACTACTTTCGTTACTATATCCATTATTGTTATCATAGTTATAATTACTACTACATC TTTTAATATATGTATCTTTTCCAATCTTTCCTAAAATGTTATAAATACTTGTGGCTGTTTGTNCTTCTTCATCGTTATTT NCATTTTTCATAGNATCCATTTCACTGTTAAAAATATTATGGTCATCAGGATTTATGGATTCCAATGTNTTCTCAAAATG AG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28687319423T095910185m3gmbPfHB3.1, G. Roman Reddy


Date: 21:20:1 on Sun 19 Nov 117.