EST 28689 is a singleton


Sequence

>28689 (1 EST) Length=221 TATATATATATATACACATAGCAACAAAATGAAACAAAATTGTTACAATTTAATTAAAAATACACANGCACATTCAAATA TATTGGGATGNGANATATCAAAAACATAAATATTTACATATTTTTTTTTTCATTGGTTTTTTTATATATATTTAAAGNTA AACACANTTACATAATATTTGTCGTTAATTTTTATTATATATTTATATGCAATACACTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28689: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28689319425T095930186m7gmbPfHB3.1, G. Roman Reddy


Date: 7:24:9 on Mon 20 Nov 117.