EST 2869 is in sequence 28694


Sequence

>28694 (1 EST) Length=368 TATATTTATATATTTATATAACATATAATTTACTTNTCATTTTATGCTTTTTTTTTTTTTTTTTTANNTTATTTTTGTTG ATGAGATATATACAAATTAAGAAGTAAGAGGATCCTCATTGCTCTTNGCTCCTTCCTCTTCTTCTTCATTATCGTCATAT TCATTTGTATCGACATTACTATTTTCATCATTGTATGCACTATTATNACTTGCATAACTATTATAGTTACTATNATTTNC ACTACTACTATAACTACTGTCGTCATCACTAACAATACTATTGCTTTTCACTCTCGNNTAATAATACCAAGGATTAATAG TCAACTGCATAGGGGTATAATTCTTTCCCTTAATCGGTAAAGGCAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 28694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28694319430T095980189m3gmbPfHB3.1, G. Roman Reddy


Date: 20:31:43 on Tue 21 Nov 117.