EST 28690 is a singleton


Sequence

>28690 (1 EST) Length=393 TAATAATATTAGTAAAATCTGTTATTTCCTCTTAGTGGTATATTATTTACATTGTTTGAACGCCCTGAACTATAGTAAGG ATTTCTNCTTTGATTATTTCCCATAGAATAAGATATTTTTNCTAATTGTGGTGGTACTGGTTGTTCCGATTCTCTTAATA TTTTAACTAAATCTTTTGCAAGTCTATATTTATCTGCTGTTAAAAATGTAAAAGAAGCACCATGAGAACCTGCTCTTCCT GTTCTTCCAATTCTATGTACATAATCTTCAATTTGATTAGGAAAATCAAAATTGNTAACATATTTAACATTTNTTTNATA TCCAATCCTCTTTGAAGGCTNCCATCCGGTTGCTATCATAAATAGGGGCCTCTTGACCCAGGTTTTAAACCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28690: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28690319426T095940187m3gmbPfHB3.1, G. Roman Reddy


Date: 19:32:42 on Sun 19 Nov 117.