EST 28693 is a singleton


Sequence

>28693 (1 EST) Length=244 ATATAATTTTACATACTTCTCTTTCTTTTATTTCTTTCTAATTTCATTTTATATTAATATTCCTTACGTTATTTATAAAT GTCACTATCCATATTAAAAGGGTAAATACAGTAAATTTTAATAACGGAAAAATATTTATATTTTNCCCCTTAATATATCT ATTACTTTCTGGTTCCATTTTCGAACTAGAATAACTTGTGGAATTATCATTAANCATTTTTTTGTATGTATAAAANTNCA TACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28693: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28693319429T095970188m7gmbPfHB3.1, G. Roman Reddy


Date: 19:14:56 on Fri 24 Nov 117.