EST 28696 is a singleton


Sequence

>28696 (1 EST) Length=335 CGTTAATGTTGCTATTCTTTCCCTGTATGGTTCCATTTTTTATATTACATATATCCTTATCATATACAATTGTTGCTAGT TCATTATCTTGTTTTAATTTATTATTTGCACAAAGAACATTTTTATGGCCTTTCCAATTTATATTTAATTTATGAATTGA TATGTCTTCACCACTATCATTATTATATACATCTGTCATACAATTACTAAACTTAAAGAATGATACAGAAAATATTAAAT CATATATTGNTCTAATATNCTTCAATTCAAATACATGCANAACTTTTTNCTCATTGTCTAAAGNTATATTACGGGCCAAA ACTTTTGCAAACTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28696: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28696319432T096000192m3gmbPfHB3.1, G. Roman Reddy


Date: 14:17:56 on Mon 20 Nov 117.