EST 28697 is a singleton


Sequence

>28697 (1 EST) Length=228 GTTTAATTATATATAATTTAACTTATTATTACGTATTATGTAAATATATCATTCGGTTGTTTTTTCTTTATTTTTTTATT TATTTATTTATTATAACCTTTTCCCACTAGATTAAAAAAACGNTTTATATTNTATTTCANANAAGTATATATAAAANCGG GGAAAAAAAAAAAAAAAAAAATGAATTCATTAANCATNATCTTTTTTTNATGTTANNTTAAATNTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28697: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28697319433T096010192m7gmbPfHB3.1, G. Roman Reddy


Date: 12:7:30 on Fri 24 Nov 117.