EST 28699 is a singleton


Sequence

>28699 (1 EST) Length=356 TTTGCATTAACAACAGAAACTGCATGGGAATCGGTTATGAGAATAAGAATTAGTAGAGGTTGGAAAATTACAAATTGGTA TGGAAATTATCAATNTAGAGGAGCAGACTTATTAGCTTTACCAAATTGTCATTCCGGTCAAAACTTTTCTATTATTGTAG ATTTAGAAGAAAATGTAGTACAAGATTCAATTGTTTATGTCCAATCAGCTTTATTATATACTAATTCTAACGGGGAAAGA AGAATACGGTTACATACATATGCTCTACCTATAACACAAAATATAAAANCTATAACTGGTTCANTAAANTCCCCCAAGTC GTTGTATCTTTGGTTAGCTCCACCCAATCTATAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28699: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28699319435T096030193m7gmbPfHB3.1, G. Roman Reddy


Date: 4:1:29 on Thu 23 Nov 117.