EST 28700 is a singleton


Sequence

>28700 (1 EST) Length=384 AAAAATCGTCATCAAATAGTTCACTGTCTTTCTTTTCAGAAGATTTATTAAACTTTCTAATTTTATAGGATGGTATAGGA TTTATAATTAAATCAAAATAAAATGGTGGCAAATCAATATCTTCTAATTTTATATATACACACATTGGTGAATGGTATTT ACTAACTGCAATTTTNCTTGGTCTATTATTATATAAATATGGAAATGCTATTTTATATTCTGTNCTTATTTGCTGACGTA TAATAATTNNATTTATGTCATTAAATTCATTCCAGTCTTCATCATCTTCATATATATCNCTATATAAGGGGGTCCAAANT TTAGGCCCNCCCTGGGNATAGCCCATAATTTAAATGGCTTTAGNCTGGTATAAAATGGCCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28700: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28700319436T096040194m3gmbPfHB3.1, G. Roman Reddy


Date: 19:11:9 on Fri 24 Nov 117.