EST 28707 is a singleton


Sequence

>28707 (1 EST) Length=286 ATGTAAGGAACAACGAATGAATCAATGTTATGTATTAAATATATATTTTTTTAAATTTCACATTTGATCTCTTTAATATT AGTTGAATATTCGTGAAAAAGATTTGTATATATTTGACGAAAATATAAATATGCAATATCCCAAAATTATAATGAATGAT TATTTTATATATTCATGATAAGATTAAGATAGAATGAGTTATGTTGTTTTATTTAAATTAGTTTATNTTTATTGTAATAA TAAAATATAATTNTTTTTTAATTGAAAATGAATATATATNATAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28707: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28707319443T096110198m7gmbPfHB3.1, G. Roman Reddy


Date: 14:4:51 on Fri 17 Nov 117.