EST 28711 is a singleton


Sequence

>28711 (1 EST) Length=381 AAAATACATCGTGATTTATAATTCCATATGTTTATTAAATGTTATTGATCTACTATGATTATTTGAAGAAAATGATTCTA CATTATTTTGTGTGGATCCTTTAAATTCTTCTTGTCCTGTGCCTACAATAATTTCTACTAGCCCACCTTGATTCGATAAA GCGCCTGAATGTATTGCAGCTTTACATAGTACTGATGTAGGACTATAAATGTTGGTTCCATAAATNTTGTCTTTTATTAT ATTGCAATTTGATGGGCAATTAATAGTTCTTTTTTCTCCTACTGNTAAATTTAATATAAATNGTCCATCAGTAGGACATG TAAAAATATTTNCTTCATTTTCTGAAAGGACCTGGNAAAAGGTCCTTAANTTGGAGATTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28711: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28711319447T096150201m3gmbPfHB3.1, G. Roman Reddy


Date: 2:5:28 on Sat 18 Nov 117.