EST 28712 is a singleton


Sequence

>28712 (1 EST) Length=341 TGTACAATGATAAAATTTAAAGATATCCTTATCTTCATTAATATTTATATATTAATTTTAAATGCATATTGTAAAGAATG GTGTAAAGCCACGTTTGAATATGGTAAGTCTGATTATGCTGAATGTATTAGTGAAGGAGATAGTATTAGTAGATATATGA TTGAAACTATTCCAATATTATCTAAAGATGTAGATTTATATAGTAATGTTTCTTTAGTTCTTTCGAATGGTTATGGTTCT AAANCAAAGGAAATAATTATAGGGAATGAAAATGATGGTTTATTAAATAAGNTTTTTACAGTTCGTTCAGATATNGGGAA TCCCNGAATATATACATATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28712: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28712319448T096160201m7gmbPfHB3.1, G. Roman Reddy


Date: 0:21:15 on Fri 24 Nov 117.