EST 28719 is a singleton


Sequence

>28719 (1 EST) Length=291 ATTCCATTATATATNATTTTATGTAAAAAATTTTAAAAATATACATTTAGAGGTGTTCGCAAATAGTCTATAATAATTAA ATATATATATATGTNAATGTAGGTTCTTGTTTTAAGGGACATATATAAATTTCACTTGTTTCATAAATATATATATATAA NCNAAATAATTTCATAACCACATGAGAATAANCAAAATGAAATTATAAGNAAAAAAAATGCAATGTTATAAAANTTTAAT TATTATAATATCCTTGTATTTTAAATCTAAAATTCACANAATATTGACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28719: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28719319455T096230205m3gmbPfHB3.1, G. Roman Reddy


Date: 2:43:13 on Sat 25 Nov 117.