EST 28722 is a singleton


Sequence

>28722 (1 EST) Length=328 TATGCCCATAAAGAAACATTAAAATATATTATAACTTACAATAATCTTTAAACGNTTCATACATGAAATCATAATTGCGT TGATTAAATNTATATTTCCTAAATTCCAAATTTTTTATATCATTGTTTTCTTCTATTTTAAAATCATCAACATTGTTCTT GAAGATTTTATCAAAAATACCCATAACATCATCTAAATTAAAATNATAATTCAAAGTATCAGATAAACTTNTATTCAGTA TTTTGTCTGAGACATTCCTAGGTACATTTGACGATTCACCCAANGNAATTAAACANTAATATATGTANGATACTCNTGAG CTACTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28722: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28722319458T096260206m7gmbPfHB3.1, G. Roman Reddy


Date: 15:51:7 on Fri 17 Nov 117.