EST 28724 is a singleton


Sequence

>28724 (1 EST) Length=271 TATATTATTTACTGATTTTTTTTTTTTTTTTTNATTTATCATAACAGGAAAATTATTTCAATTATATCACATATCAACAA CTACCAATGATACTATAACTTATTATTCTCAATTTCATGATAATATAATAAGGGAAGATGAAAAAGGAAATGTTAATATG GNAATAATAATATAATCACAAAATAAANTACATACATATATATTATATTATANTAATCTNTTTATTTTNCATNNCTATAT ATATTAGCCCTATGTNGCAAATATAACACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 28724: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28724319460T096280207m7gmbPfHB3.1, G. Roman Reddy


Date: 19:16:44 on Wed 22 Nov 117.