EST 28729 is a singleton


Sequence

>28729 (1 EST) Length=257 GTATAATTCAATTGATTATAGTAAGGTGATTTTATATCCATATTATTATTTTAATTTAACCTTGCTCAAAGCCTTTCCAA CATACCTGTTCTTATCATCATTTACAATAATTATACTTTTTTGGTCACAAGTTTATTATGCATCAGTGTTAGTGTCCTCC CCACACTTACAGTAATGAAAAAATAAATAAAAATATATGTATTTNAATTAATATATATTAACATGCATGGACATAATAAT CTATTTTTAATATAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28729: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28729319465T096330210m3gmbPfHB3.1, G. Roman Reddy


Date: 15:5:54 on Wed 22 Nov 117.