EST 28730 is a singleton


Sequence

>28730 (1 EST) Length=322 TTATGTTCTTTTATGTGACAATTTAGATAGTTTAATTTTTACATTGGCTGCTACAGAATTAATATGAATTTGCTTATATA CAGCTGTTTTAACAAAAGTATTTGCTTTTTTTTAAGAAGAGACTTATATTTGAAAAAAAAGAATTGTACTAAAGTAAGTT TTTTTAATTATTTTAATTCGAAAGAATGGAATAGATACGNGAAAAGGATACGNAAAAAAAGTATAATATTACAAAATGAT GCAATATCAAATAAATTTTATATAAAANNTAAANTTTTTTGTAATAAAAATGTATTACTACTACCTTTGGNATATAAAAC CA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28730: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28730319466T096340210m7gmbPfHB3.1, G. Roman Reddy


Date: 1:40:11 on Sun 19 Nov 117.