EST 28732 is a singleton


Sequence

>28732 (1 EST) Length=396 CTTGTATGGACAAAATAAGAAAGGAAGAAAAAAAAGAAAAGAAAAGAAAAGTATGGAACTTTCAAAAGGAAAAGTTATTA TTGAAAAAGATATAAATGAACACACCATAGATGACGAAGTGTTTATGTTTGAACCTAGCATTGATGATGTGTATGATAAG AATACGAATTTACGGTTTATATTTCATAATACATTTATAACATCAGAAGANGAAATAGCTATAAGTGAATTTAGAAAATA TTGTAAGAGTAGATGCTTAAAAATTAATAAAATATATTTCGAAAATGAATGCTTACGTTATTTATATTCAGCACAATTTG ATTTTTCCTAAGGCCATGGNATTANTAAANCGTAATTATGNATTCCGGTTATCATCTATTTTACCCNATTAAACGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28732: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28732319468T096360211m7gmbPfHB3.1, G. Roman Reddy


Date: 2:25:47 on Thu 23 Nov 117.