EST 28735 is a singleton


Sequence

>28735 (1 EST) Length=190 TGTATATATTTATTTATTGAATATGTTTTTATTTTTCACGAAAAAAAGAAAACATTAATGGGGGGTGGGTACGTGTCCAT CCACATAAAAATTTCTTGTCATTGGGGGTAATTGTATTTTCATACCATCCAATTCTTTACTTAGTTTTATTTGACATCCT AATCTGGATCTGGAAAAAAAAAAAAAAAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 28735: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28735319471T096390213m3gmbPfHB3.1, G. Roman Reddy


Date: 21:37:33 on Fri 24 Nov 117.