EST 2874 is in sequence 28740


Sequence

>28740 (1 EST) Length=390 TTAATTTTNTTTTTATGTATAATCCTTTTGGTATTGAAACCCCTTTTTTTTTTTTTTTTGTCATTTAATATTTATTCATA AATATTGTGAGTGTTCATCTTGCCATATAATAACTTTTGGGTCTCTCTTACAAAAGGCACGAACAGCCATAGCCAAATTA TCATNGTCATCCATTATTCNCCCTTTACATCCNAATTTTATTTTTTCAGGAATATTTTCTNCTCCTTGATATATAATACG TTTCGCATCTGTTACTGTTACGTTGTCATCTAAATAAAATTTGGANCCATTCTTCCATTTCATTNNTTTTCTNGACTATA ATACTGTCTATAAGGANGGGTATAATTNGCTCGGTCANGANTATAAAAAAAAAATTNCCCTAGGCTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28740: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28740319476T096440216m7gmbPfHB3.1, G. Roman Reddy


Date: 14:19:49 on Fri 17 Nov 117.