EST 28745 is a singleton


Sequence

>28745 (1 EST) Length=268 TTAATTTATGTATTAATTTGTTGATTTATTTTAATGAGAATGACATGGATAAAAAAAAAATTAATTTTCTTTGTATAAGG AGATATGATAAAATTTATAAAATTAAAAAGGGTCCATATTAATTTAATAATAATACTTATAATATATATTGCATCGATAA AGATATATAATGTAAGANAAGTGCAATGTATAANTTCGACAAAGCATAATAATAATATAANATTTCAAAGTCGTAAAGGT AATAGGCTATTTTATTTAATCAATAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 28745: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
28745319481T096490219m3gmbPfHB3.1, G. Roman Reddy


Date: 12:23:4 on Fri 17 Nov 117.